Manuscript Tables 1-3 and References.

Table 1. Primers Used to Amplify Specific Regions of the LSU rRNA Gene from Oyster (Crassostrea virginica) Genomic DNA and cDNA Template.

Primers marked with * are from reference 37. The final set of primers was used to amplify scallop (*Argopecten irradians*) genomic DNA and cDNA, and would amplify in *C. virginica* cDNA if the fragments were spliced post-transcriptionally.
Region	Primer	5' to 3' Oligonucleotide Sequence	Product Length	Annealing Temperature
5' portion	mt168-F *	GGATTCTGTTTGTCCGCAGCATT	233 bp	50 °C
5' portion	mt169-R *	CACCATATAGCTATCTTTAGTTGA	233 bp	50 °C
3' portion	mt89-F *	CAGTACCTGCCCAGTGCGACAA	494 bp	58 °C
3' portion	16SBR	CCGGTCTGAACTCAGATCACGT	494 bp	58 °C
Full LSU rRNA	dCv-Ai-LSU-f	CTTTWGCAKMATGGCYTTWTGAG	~773 bp in C. virginica 748 bp in A. irradians	55 °C
Full LSU rRNA	dCv-Ai-LSU-r	CACGGGGTCTTCTTGTCTWWCTTT	~773 bp in C. virginica 748 bp in A. irradians	55 °C

Table 2. Summary of Large Subunit Molecular Characteristics for Crassostrea virginica, C. gigas, and C. hongkongensis.

	Measurement	C. virginica [37]	C. gigas [37]	C. hongkongensis [38, 39]
Large Subunit, 5'	Length (nt)	748	587	605
	Percent A+T	65.9	69.4	67.9
	Percent G+C	34.1	30.6	32.1
Large Subunit, 3'	Length (nt)	719	713	712
	Percent A+T	61.4	61.4	62.1
	Percent G+C	38.6	38.6	37.9

Table 3. Percent Sequence Similarity between Crassostrea virginica, C. gigas, and C. hongkongensis.

* Similarities for the LSU 5' and LSU 3' are presented above and below the diagonal respectively.
LSU *	C. virginica [37]	C. gigas [37]	C. hongkongensis [38, 39]
C. virginica	-	65.0	65.0
C. gigas	83.0	-	89.0
C. hongkongensis	84.0	96.0	-

References:

Reference numbers refer to the numbering system used in the published manuscript.
#	Reference	Reference Links
37.	Milbury C.A. and Gaffney P.M. (2005). Complete mitochondrial DNA sequence of the eastern oyster Crassostrea virginica. Marine Biotechology, 7(6):697-712.	[ PM \| pmc \| DOI ]
38.	Yu Z., Wei Z., Kong X., and Shi W. (2008). Complete mitochondrial DNA sequence of oyster Crassostrea hongkongensis - a case of "Tandem duplication-random loss" for genome rearrangement in Crassostrea? BioMed Central Genomics, 9:477.	[ PM \| PMC \| DOI ]
39.	Ren J., Liu X., Zhang G., Liu B., and Guo X. (2009). "Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes: comment. BioMed Central Genomics, 10:84.	[ PM \| PMC \| DOI ]