Table 1. Primers Used to Amplify Specific Regions of the LSU rRNA Gene from Oyster (Crassostrea virginica) Genomic DNA and cDNA Template.
| Region | Primer | 5' to 3' Oligonucleotide Sequence | Product Length | Annealing Temperature |
|---|---|---|---|---|
| 5' portion | mt168-F * | GGATTCTGTTTGTCCGCAGCATT | 233 bp | 50 °C |
| mt169-R * | CACCATATAGCTATCTTTAGTTGA | |||
| 3' portion | mt89-F * | CAGTACCTGCCCAGTGCGACAA | 494 bp | 58 °C |
| 16SBR | CCGGTCTGAACTCAGATCACGT | |||
| Full LSU rRNA | dCv-Ai-LSU-f | CTTTWGCAKMATGGCYTTWTGAG | ~773 bp in C. virginica 748 bp in A. irradians |
55 °C |
| dCv-Ai-LSU-r | CACGGGGTCTTCTTGTCTWWCTTT |
Table 2. Summary of Large Subunit Molecular Characteristics for Crassostrea virginica, C. gigas, and C. hongkongensis.
| Measurement | C. virginica [37] | C. gigas [37] | C. hongkongensis [38, 39] | |
|---|---|---|---|---|
| Large Subunit, 5' | Length (nt) | 748 | 587 | 605 |
| Percent A+T | 65.9 | 69.4 | 67.9 | |
| Percent G+C | 34.1 | 30.6 | 32.1 | |
| Large Subunit, 3' | Length (nt) | 719 | 713 | 712 |
| Percent A+T | 61.4 | 61.4 | 62.1 | |
| Percent G+C | 38.6 | 38.6 | 37.9 |
Table 3. Percent Sequence Similarity between Crassostrea virginica, C. gigas, and C. hongkongensis.
| LSU * | C. virginica [37] | C. gigas [37] | C. hongkongensis [38, 39] |
|---|---|---|---|
| C. virginica | - | 65.0 | 65.0 |
| C. gigas | 83.0 | - | 89.0 |
| C. hongkongensis | 84.0 | 96.0 | - |
References:
| # | Reference | Reference Links |
|---|---|---|
| 37. |
Milbury C.A. and Gaffney P.M. (2005).
Complete mitochondrial DNA sequence of the eastern oyster Crassostrea virginica. Marine Biotechology, 7(6):697-712. |
[ PM | pmc | DOI ] |
| 38. |
Yu Z., Wei Z., Kong X., and Shi W. (2008).
Complete mitochondrial DNA sequence of oyster Crassostrea hongkongensis - a case of "Tandem duplication-random loss" for genome rearrangement in Crassostrea? BioMed Central Genomics, 9:477. |
[ PM | PMC | DOI ] |
| 39. |
Ren J., Liu X., Zhang G., Liu B., and Guo X. (2009).
"Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes: comment. BioMed Central Genomics, 10:84. |
[ PM | PMC | DOI ] |
